JMA Journal
  • Twitter
  • Feed
  • Mail
Table 1. Primer Sequences and Probe Number for Real-time PCR.

From: Hepatocyte-like Cells Derived from Human Pluripotent Stem Cells Can Be Enriched by a Combination of Mitochondrial Content and Activated Leukocyte Cell Adhesion Molecule

Target human genes Foward primer Reverse primer Probe number
POU5F1 cttcgcaagccctcatttc gagaaggcgaaatccgaag 60
LIN28A ccgtgtccaaccagcagt acgttgaaccacttacagatgc 83
HNF4A cagcactcgaaggtcaagcta acgggggaggtgatctgt 66
AFP atggccatcaccagaaaaat cataagtgtccgataataatgtcagc 66
ALB gtgaggttgctcatcggttt gagcaaaggcaatcaacacc 7
CYP3A4 gatggctctcatcccagactt agtccatgtgaatgggttcc 2
ACTN2 catgatccaggaggaggaggagt acaccaggcagtgaaggtct 7
NKX2.5 cacctcaacagctccctgac aatgcaaaatccaggggact 7
GAPDH agccacatcgctcagacac gcccaatacgaccaaatcc 60
» Back to article page
Table 2. Antibody List for Immunocytochemistry.

From: Hepatocyte-like Cells Derived from Human Pluripotent Stem Cells Can Be Enriched by a Combination of Mitochondrial Content and Activated Leukocyte Cell Adhesion Molecule

Target Antigen Primary antibodies Manufacturer Catalog No.
Alcam/CD166 Goat Polyclonal IgG R&D AF1172
HNF4α Rabbit Polyclonal IgG Santa cruz SC-8987
α-Fetoprotein (AFP) Mouse monoclonal IgG2a (clone C3) Sigma-Aldrich A8452
Albumin Rabbit Polyclonal IgG Dako A0001
Human Nuclei Mouse monoclonal IgG1 (clone 235-1) Chemicon MAB1281
α-Actinin (Sarcomeric) Mouse monoclonal IgG1 (clone EA-53) Sigma-Aldrich A7811
Oct-3/4 Mouse monoclonal IgG1 BD 611202
Target Species Secondary antibodies Manufacturer Catalog No.
Goat IgG (H+L) Donkey Alexa Fluor 488 Invitrogen A-11055
Goat IgG (H+L) Donkey Alexa Fluor 546 Invitrogen A-11056
Rabbit IgG (H+L) Donkey Alexa Fluor 488 Invitrogen A-21206
Rabbit IgG (H+L) Donkey Alexa Fluor 546 Invitrogen A-10040
Mouse IgG (H+L) Donkey Alexa Fluor 488 Invitrogen A-21202
Mouse IgG (H+L) Donkey Alexa Fluor 546 Invitrogen A-10036
» Back to article page
PAGE TOP